Daphnia magna genome assembly 2.4 (date 2010.04.22)
genomic 454 reads mapped to assembly, paired (_1) and unpaired (_u) of 
read files pairs.*.sff and GBUN2NT*.sff listed in dmagna20100422assembly.summary,
converted to fastq with SffToCA of Celera assembler, mapped to genome with bowtie2.

   Subset label		Read files
a. dmag24gflxs13r2  	pairs.s1[0123]r[12].sff
b. dmag24gflxs9r2 	pairs.s[789]r[12].sff
c. dmag24gtitGBUN2NT02  GBUN2NT0[12].sff
d. dmag24gtits14l  	pairs.s14l*.sff

==> bowgnloc/dmagna20100422assembly-dmag24gflxs13r2_1.fstat <==
881680 + 0 in total (QC-passed reads + QC-failed reads)
864272 + 0 mapped (98.03%:-nan%)
84004 + 0 properly paired (9.53%:-nan%)
861642 + 0 with itself and mate mapped
408314 + 0 with mate mapped to a different chr

==> bowgnloc/dmagna20100422assembly-dmag24gflxs13r2_u.fstat <==
1623266 + 0 in total (QC-passed reads + QC-failed reads)
1592735 + 0 mapped (98.12%:-nan%)

==> bowgnloc/dmagna20100422assembly-dmag24gflxs9r2_1.fstat <==
578384 + 0 in total (QC-passed reads + QC-failed reads)
566905 + 0 mapped (98.02%:-nan%)
54798 + 0 properly paired (9.47%:-nan%)
565086 + 0 with itself and mate mapped
268946 + 0 with mate mapped to a different chr

==> bowgnloc/dmagna20100422assembly-dmag24gflxs9r2_u.fstat <==
1141777 + 0 in total (QC-passed reads + QC-failed reads)
1120693 + 0 mapped (98.15%:-nan%)

==> bowgnloc/dmagna20100422assembly-dmag24gtitGBUN2NT02_1.fstat <==
738358 + 0 in total (QC-passed reads + QC-failed reads)
730933 + 0 mapped (98.99%:-nan%)
249144 + 0 properly paired (33.74%:-nan%)
729458 + 0 with itself and mate mapped
293658 + 0 with mate mapped to a different chr

==> bowgnloc/dmagna20100422assembly-dmag24gtitGBUN2NT02_u.fstat <==
711927 + 0 in total (QC-passed reads + QC-failed reads)
703539 + 0 mapped (98.82%:-nan%)

==> bowgnloc/dmagna20100422assembly-dmag24gtits14l4r8_1.fstat <==
1279698 + 0 in total (QC-passed reads + QC-failed reads)
891073 + 0 mapped (69.63%:-nan%)
99038 + 0 properly paired (7.74%:-nan%)
883424 + 0 with itself and mate mapped
512354 + 0 with mate mapped to a different chr

==> bowgnloc/dmagna20100422assembly-dmag24gtits14l4r8_u.fstat <==
1502088 + 0 in total (QC-passed reads + QC-failed reads)
1271784 + 0 mapped (84.67%:-nan%)

================================

Note that d. dmag24gtits14l has much lower genome map rate than others,
unsure why. This is early 454 titanium (longer) read set than GBUN set.
May include greater read error rate (400-1000bp reads), and has longest 
pair insert sizes 17kb, versus 2kb insert, 200-300bp reads of pairs flx set
or 8kb inserts, 400-1000bp reads of GB titan set.

Note that while the reads are mate paired on input, resulting machine output
with errors limits detection of mate linker sequences of Roche 454 to under 50%
by the SffToCA software (Roche's Nimblegen likely does better).  Eg. for

input sff               GBUN2NT01.sff
output fragments        dmag24gtitGBUN2NT01.frg
linker                  TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG (Titanium)
INPUT
numReadsInSFF           568937
                        -------
LINKER
not examined            5217
none detected           156046
inconsistent            28678
partial                 196240
good                    182756
                        -------
OUTCOME
fragment                352286
mate pair               182756
deleted inconsistent    28678
deleted duplicate       5209
deleted too short       8
deleted N not allowed   0
                        -------
                        568937

=================================

sff conversion:
http://wgs-assembler.sourceforge.net/wiki/index.php/SffToCA

needed options: 
  -linker titanium|flx ;  need both for diff libs
  linker requires -insertsize per lib, see dmag24sff.pairins from assembly.summary
  -trim chop is recommended, default used 1st pass (-trim hard)

caopts="-linker flx -linker titanium -trim chop"
$cabin/sffToCA $caopts -libraryname dmag24g -output dmag24g$pt -insertsize $pins $pt.sff 

then convert frg to fastq parts:
  frg2fq.pl *.frg

env lib=dmag24g cabin=$cabin  perl -ne \
'BEGIN{ $libna=$ENV{lib}||"dmag24g"; $outna=$ENV{out}||$libna;
$caopts=$ENV{caopts}||"-linker titanium -linker flx -trim chop"; $cabin=$ENV{cabin}||""; }
if(m/^libraryName\s+(\S+)/) { $ln=$1; }
elsif($ln and ($t,$v)=m/^pairDistance(\w+)\s(\d+)/) { push @{$lnv{$ln}},$v; }
BEGIN{ $libna=$ENV{lib}||"dmag24g"; $outna=$ENV{out}||$libna; }
sub runsff2ca { my($pt,$libfile,$insa,$insd)=@_;
my $cmd="${cabin}sffToCA $caopts -libraryname $libna -output $outna$pt -insertsize $insa $insd $libfile";
warn("# $cmd\n"); if(-f $libfile) { $ok= system($cmd); } else { warn "#err in params\n"; $ok=0; }
return $ok; }
END{ for $ln (sort keys %lnv) {
$pt=$ln; $pt=~s/.sff//; $pt=~s/pairs.//;
@ins= @{$lnv{$ln}}; print "pt=$pt; pins=\"@ins\"; \n";
runsff2ca($pt,$ln,@ins) if($cabin); } }' \
dmagna20100422assembly.summary  \
  > dmag24sff.pairins